Locus CJD PRNP
Disease ID
CJD
Gene ID
PRNP
Updated
Jul 15, 2026
v2.24.0
v2.24.0
Other gene loci
–
Clinical Links
Bioinformatical Links
Disease
–
Name Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome
Inheritance
Description Inherited or familial Creutzfeldt-Jakob disease (fCJD) and Gerstmann-Straussler-Schneiker syndrome (GSS) are rare forms of genetic prion disease characterized by cognitive difficulties, ataxia, and myoclonus1 . These diseases are associated with the larger Prion Disease phenotypic spectrum, but other phenotypes have not been associated with this tandem repeat2 .
Prevalence
HPO Terms
–
Association
Mendelian
Locus
Details Normal PRNP alleles have one nonapeptide followed by four octapeptide tandem repeat sequences, each of which comprises the amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln; any additional repeat leads to pathogenicity, with the largest repeat observed 16 motifs1 . Insertion length may correspond to phenotype, such as CJD versus frontotemporal dementia6 . Insertions occur in the N-terminal domain, outside of the protease-resistant core that constitutes the infectious PrPSc particle7 .
Mechanism Insertions increase self association of the N-terminal octarepeat domain and its interaction with the adjacent polybasic tail, which is proposed to accelerate conversion of the protein to a PrPSc-like state without directly altering the amyloidogenic core8,9 . 8 or more repeats also alter copper ion coordination and increase binding affinity. This is correlated with a sharp decrease in age of onset, though it is unclear if this is causal or a correlated consequence10 .
GoF/LoF?
Detection
Alleles
Ref. Motif Reference motif, reference orientation
GGTGGTGGCTGGGGGCAGCCTCAT
Ranges
Benign (ref.) Benign motif, reference orientation
–
Benign (gene) Benign motif, gene orientation
–
Pathogenic (ref.) Pathogenic motif, reference orientation
AGCCTCATGGTGGTGGCTGGGGGC
Pathogenic (gene) Pathogenic motif, gene orientation
AGCCTCATGGTGGTGGCTGGGGGC
Unknown (ref.) Unknown motif, reference orientation
–
Unknown (gene) Unknown motif, gene orientation
–
Interruption (ref.) Interruption motif, reference orientation
–
Interruption (gene) Interruption motif, gene orientation
–
gnomAD
References
Direct supporting references for info on this page.
2
Genetic Creutzfeldt–Jakob disease
Handbook of Clinical Neurology · 2018-01-01
doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-13
Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions
Stephanie E.,Wallace, Lora JH,Bean
GeneReviews® [Internet] · 2022-10-20
genereviews:NBK5351485
Genetic screening for Huntington disease phenocopies in Sweden: A tertiary center case series focused on short tandem repeat (STR) disorders.
Martin,Paucar, José,Laffita-Mesa, Valter,Niemelä, Helena,Malmgren, Inger,Nennesmo, Kristina,Lagerstedt-Robinson, Magnus,Nordenskjöld, Per,Svenningsson
Journal of the neurological sciences · 2023-06-10
pmid:373797246
Genetic Creutzfeldt‒Jakob disease with 5-octapeptide repeats presented as frontotemporal dementia.
Shinsuke,Hamada, Ikuko,Takahashi-Iwata, Katsuya,Satoh, Tetsuyuki,Kitamoto, Hidehiro,Mizusawa, Fumio,Moriwaka, Ichiro,Yabe
Human genome variation · 2023-03-29
pmid:369776848
The octapeptide repeats of prion protein play critical roles in the pathogenesis of prion diseases.
Xiangyi,Zhang, Jingjing,Zhang, Yan,Zhang, Dan,Wang, Gaixiu,Liu, Mengfei,Wang, Chaoyang,Li, Qi,Shi, Xiaoping,Dong, Chonggang,Yuan, Wenlong,Li, Jiyan,Ma
Acta neuropathologica communications · 2026-04-22
pmid:4202141311
Transmissible familial Creutzfeldt-Jakob disease associated with five, seven, and eight extra octapeptide coding repeats in the PRNP gene.
L G,Goldfarb, P,Brown, W R,McCombie, D,Goldgaber, G D,Swergold, P R,Wills, L,Cervenakova, H,Baron, C J,Gibbs, D C,Gajdusek
Proceedings of the National Academy of Sciences of the United States of America · 1991-12-01
pmid:1683708Additional Literature
Additional literature related to this locus.
Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem
repeats, and disease, in medline format)
The octapeptide repeats of prion protein play critical roles in the pathogenesis of prion diseases.
Xiangyi,Zhang, Jingjing,Zhang, Yan,Zhang, Dan,Wang, Gaixiu,Liu, Mengfei,Wang, Chaoyang,Li, Qi,Shi, Xiaoping,Dong, Chonggang,Yuan, Wenlong,Li, Jiyan,Ma
Acta neuropathologica communications · 2026-04-22
pmid:42021413Novel polymorphisms and functional characterization of the prion protein gene in sparrows (
Chau-Giang,Truong, Da-In,Choi, Byung-Hoon,Jeong
Frontiers in veterinary science · 2026-03-11
pmid:41890154Repeat Variants, Biomarkers, and Molecular Signatures in Parkinson's Disease:
Jose Miguel,Laffita-Mesa, Martin,Paucar, Per,Svenningsson
International journal of molecular sciences · 2025-09-20
pmid:41009775Highly conserved prion protein sequences in random bred cats with three novel synonymous PRNP gene variants.
Canan,Güven, Iraz,Akış
Topics in companion animal medicine · 2025-08-11
pmid:40803449Clinical, neuropathological, and molecular characteristics of rapidly progressive dementia with Lewy bodies: a distinct clinicopathological entity?
Giuseppe Mario,Bentivenga, Simone,Baiardi, Andrea,Mastrangelo, Edoardo,Ruggeri, Angela,Mammana, Alice,Ticca, Marcello,Rossi, Sabina,Capellari, Piero,Parchi
Alzheimer's research & therapy · 2024-09-10
pmid:39256877Clinical and Molecular Findings of Intermediate Allele Carriers in the HTT Gene from the Mexican Mestizo Population.
Miguel Ángel,Ramírez-García, David José,Dávila-Ortiz de Montellano, Leticia,Martínez-Ruano, Adriana,Ochoa-Morales, Sandra,Romero-Hidalgo, Juan Carlos,Zenteno, Petra,Yescas-Gómez
Neuro-degenerative diseases · 2022-08-04
pmid:35926480Novel Polymorphisms and Genetic Characteristics of the Prion Protein Gene in Pheasants.
Kyung Han,Kim, Yong-Chan,Kim, Byung-Hoon,Jeong
Frontiers in veterinary science · 2022-07-12
pmid:35903139Genetic landscape of early-onset dementia in Hungary.
Dora,Csaban, Anett,Illes, Toth-Bencsik,Renata, Peter,Balicza, Klara,Pentelenyi, Viktor,Molnar, Andras,Gezsi, Zoltan,Grosz, Aniko,Gal, Tibor,Kovacs, Peter,Klivenyi, Maria Judit,Molnar
Neurological sciences : official journal of the Italian Neurological Society and of the Italian Society of Clinical Neurophysiology · 2022-06-25
pmid:35752680Prion protein gene mutation detection using long-read Nanopore sequencing.
François,Kroll, Athanasios,Dimitriadis, Tracy,Campbell, Lee,Darwent, John,Collinge, Simon,Mead, Emmanuelle,Vire
Scientific reports · 2022-05-18
pmid:35585119